SGN Marker solcap_snp_sl_100920

SGN-M18460

Synonyms  
SGN-U584905_snp984
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54791)
Chromosome
10
Position
1.68 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CCAAGGGAGGACTGCAAAGAGAGTGTGTCTGGATATGAAAAGGCAAGAAT
  
3' flanking region
GAGTGTAGTGACAATGTTGGTATCCACAATGCTGTGAGATTTGCCAATCC
SNP nucleotide
TG
SNPdb format
CCAAGGGAGGACTGCAAAGAGAGTGTGTCTGGATATGAAAAGGCAAGAAT[T/G]
GAGTGTAGTGACAATGTTGGTATCCACAATGCTGTGAGATTTGCCAATCC
  
Genomic location of solcap_snp_sl_100920  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18460 marker 18460
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)