SGN Marker solcap_snp_sl_100922

SGN-M18462

Synonyms  
SGN-U585500_snp277
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67006)
Chromosome
4
Position
55.35 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63480)
Chromosome
4
Position
62.21 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54793)
Chromosome
4
Position
52.82 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTCTTCATTCATTTCTGCTCATACTCAAAACAATGCTTCATCAACAACAA
  
3' flanking region
AAGAAGAATATTGAAACTACACATTGATGATAATCCTCAACCAATTAAGA
SNP nucleotide
CG
SNPdb format
TTCTTCATTCATTTCTGCTCATACTCAAAACAATGCTTCATCAACAACAA[C/G]
AAGAAGAATATTGAAACTACACATTGATGATAATCCTCAACCAATTAAGA
  
Genomic location of solcap_snp_sl_100922  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18462 marker 18462
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)