SGN Marker solcap_snp_sl_100935

SGN-M18475

Synonyms  
SGN-U590370_snp65846
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70487)
Chromosome
2
Position
61.04 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67014)
Chromosome
2
Position
80.89 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63487)
Chromosome
2
Position
111.77 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54806)
Chromosome
2
Position
44.06 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ACTCCGATTTTTCGAGAATCAAGTGAGTTGGAGATTGGAACAGAGGAAAC
  
3' flanking region
AAAGGAATTTAACCGTGTAAAGGAAAAAATTAAACACACTGTATTTGGTG
SNP nucleotide
TG
SNPdb format
ACTCCGATTTTTCGAGAATCAAGTGAGTTGGAGATTGGAACAGAGGAAAC[T/G]
AAAGGAATTTAACCGTGTAAAGGAAAAAATTAAACACACTGTATTTGGTG
  
Genomic location of solcap_snp_sl_100935  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18475 marker 18475
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)