SGN Marker solcap_snp_sl_100941

SGN-M18481

Synonyms  
SGN-U594049_snp94598
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70490)
Chromosome
4
Position
76.24 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67017)
Chromosome
4
Position
85.07 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63489)
Chromosome
4
Position
122.62 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54812)
Chromosome
4
Position
60.55 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AAACGAGAGAGGATTTATTGAATCTGGGTTTGATCTCAAATCGAAGATAC
  
3' flanking region
CTTGGATTCGTTCATTTTTCGATGGTTTTTTAACCTGGGAAGAGTTATTA
SNP nucleotide
AG
SNPdb format
AAACGAGAGAGGATTTATTGAATCTGGGTTTGATCTCAAATCGAAGATAC[A/G]
CTTGGATTCGTTCATTTTTCGATGGTTTTTTAACCTGGGAAGAGTTATTA
  
Genomic location of solcap_snp_sl_100941  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18481 marker 18481
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)