SGN Marker T1227

SGN-M1849
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 1.01.01
Tomato EST read: TPTAB70TH
Arabidopsis best BAC match: AB007646.1
Arabidopsis position: 5.2790000
Arabidopsis identities: 0.882
Best GenBank protein hit: BAB11037.1
Evalue: 1.5e-43
Identities: 0.656
Description: histidinol dehydrogenase [Arabidopsis thaliana]
Comment: Histidinol dehydrogenase (HDH) catalyzes two sequential oxidation reactions to produce histidine from histidinol via histidinaldehyde.
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39549)
Chromosome
2
Position
53.50 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1227 was used as an overgo probe on plate 11 [well B8]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CATTGAGTAGGTCCTGTAGCTTGG
B sequence
GCCCGAAGATTACTAGCCAAGCTA
AB sequence
CATTGAGTAGGTCCTGTAGCTTGGCTAGTA
Marker sequence
GCCTCGTGCCGATCTTTCTCCGGCGACGACCTCTAATTAACATTGATGGA
CCTGCAACATTCTATCATTGAGTAGGTCCTGTAGCTTGGCTAGTAATCTT
CGGGCCAATTCCTACCACCGCCAATACCTGTATTTTATCGGAAATATTCT
TATCTACCCTGCAGGGTTAATTCGTAAGTCAATTAGGTGCCTCAATGAAG
TCGTATAAGTTATCGGAGCTTACCAACCTCTGAGGTTGACCAGCCTCAAG
GCTCGTCCTCGCATTGATTTCTCCTCCATTTTCGGCACCAGTTCAACCCA
TTGTTGATGATGTTCGTAATAGAGGTGATGCTGCAGTTAAAGATTACCAC
CATCGCGGTTTGACCAAAGTTGTCCTGGATAAGATAGTTGAAGATGTCAG
TGAGCCTTCCGATCCCGAGCTCGATTCATCTGTTCGAGAAGCATTTGATG
TGGCATATAACACCATATATGCCTTTCATGCTGCTCAAAAGCCTGTTGAG
AAAGTTGTTGAGAACCATCATGGGGTCAGATGTAAACGTGTCGCTAGGAG
CATTGCCTCTGTAGGGCTTTATGTTCCTGGTGGAACTGCTGTTTTACCTT
CTACAGCTCTGATGCTTTCAGTTCCAGCACAAATTGCTGGATGT
Genomic location of T1227  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1849 marker 1849
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)