Notice: Due to a server issue, SGN was unavailable earlier today. We apologize for any inconvenience.

SGN Marker solcap_snp_sl_100950

SGN-M18490

Synonyms  
SGN-U603632_snp167
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70498)
Chromosome
12
Position
80.26 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54821)
Chromosome
12
Position
64.60 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TAATAACTTGAATAACAACCAATTTGTCACTTGTTTTTTCTACCTAACCA
  
3' flanking region
ACTAAGAAGCATTAACAAATTTTACCAAATCTTGCTTTTGGGTGTCAAAG
SNP nucleotide
AT
SNPdb format
TAATAACTTGAATAACAACCAATTTGTCACTTGTTTTTTCTACCTAACCA[A/T]
ACTAAGAAGCATTAACAAATTTTACCAAATCTTGCTTTTGGGTGTCAAAG
  
Genomic location of solcap_snp_sl_100950  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18490 marker 18490
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)