SGN Marker T1228

SGN-M1850
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTAB71TH
Arabidopsis best BAC match: AC008051.3
Arabidopsis position: 1.1045000
Arabidopsis identities: 0.766
Best GenBank protein hit: AAF82253.1
Evalue: 8.8e-94
Identities: 0.798
Description: Identical to gene ZW18 from Arabidopsis thaliana {Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39550)
Chromosome
1
Position
80.00 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
A


Tomato-EXPEN 2000

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39551)
Chromosome
5
Position
67.00 cM
Confidence
I
Protocol
RFLP
Subscript
B


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1228 was used as an overgo probe on plate 8 [well D10]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P303A03,   P252J23,   P019G04,   P021C07,   P188D15,   P317B12,   P021M03,   P269J23,   P304G22

 Overgo Sequences

A sequence
TCCAGGGACATCATTTAGACTTGC
B sequence
TGGTTTCGAACAAGGCGCAAGTCT
AB sequence
TCCAGGGACATCATTTAGACTTGCGCCTTG
Marker sequence
GAAAAGATTCATGGCGCAATCCCATGTCAAAATGGCCGTGTTTTGAAGAT
TGTGGTTTTTGTCCATGGATTCCAGGGACATCATTTAGACTTGCGCCTTG
TTCGAAACCAGTGGCTTTTAATAGATCCCAAGATGGAGTTTCTTATGTCA
GAAGTTAATGAAGAAAAAACAGCGGGAGACTTTAGAGAAATGGGCTTAAG
ACTGGCACAAGAAGTAACTTCTTTCATAAAAAAGAAGATGGACAAAGCCT
CAAGATCTGGAAATTTGAAGACTATTAAGCTAAGTTTTGTTGGACATTCC
ATTGGGAACATCATATTAAGAACAGCTTTAACAGAGAGCATCATGGAACC
ATATCTCAGGTTCCTTCACACGTATGTTTCTGTATCTGGTCCACATCTAG
GTTACCTGTACAGTTCAAATTCTTTGTTCAATTCTGGGTTGTGGCTCTTG
AAGAAGCTCANGGGCACACCATGCATACATCAGCTTACATTTACAGATGA
TCCTGATCTCCGGAATACATTCTTGTACAAACTTTGCAAGCAAAGGTCCT
TGGAAAATTTCAAGAATATTATTTTGGTATCTTCACCTCAGGATGGGTAT
GTTCCATATCATTCTGCAGGAATCGAGATGTGTCAAGC
Genomic location of T1228  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1850 marker 1850
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)