SGN Marker solcap_snp_sl_100960

SGN-M18500

Synonyms  
SL1_00sc6004_1204932
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54831)
Chromosome
11
Position
51.37 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GAACGAAGGATCTGCTGATATGTTGGAACAAAGTCGGCACATGTCCTATT
  
3' flanking region
CAGAGGAGAAGATGGTCACTTTGAGAAATTGAAACAACTCTCTGAATCAG
SNP nucleotide
AC
SNPdb format
GAACGAAGGATCTGCTGATATGTTGGAACAAAGTCGGCACATGTCCTATT[A/C]
CAGAGGAGAAGATGGTCACTTTGAGAAATTGAAACAACTCTCTGAATCAG
  
Genomic location of solcap_snp_sl_100960  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18500 marker 18500
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)