SGN Marker solcap_snp_sl_100973

SGN-M18512

Synonyms  
SL1_00sc6004_1941013
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70580)
Chromosome
11
Position
83.34 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54843)
Chromosome
11
Position
52.11 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AATGAAAGTGAGTAAATTACCTCCCTATGATCCAACCAAGAATTTTAGTA
  
3' flanking region
ATATCCTGAGTTCTTGAAAAGTGAATCCGCCACGAATTTGGACTCCTCAA
SNP nucleotide
TC
SNPdb format
AATGAAAGTGAGTAAATTACCTCCCTATGATCCAACCAAGAATTTTAGTA[T/C]
ATATCCTGAGTTCTTGAAAAGTGAATCCGCCACGAATTTGGACTCCTCAA
  
Genomic location of solcap_snp_sl_100973  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18512 marker 18512
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)