SGN Marker solcap_snp_sl_100975

SGN-M18514

Synonyms  
SL1_00sc6004_1941124
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70582)
Chromosome
11
Position
83.34 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54845)
Chromosome
11
Position
52.13 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GTACAGTCCTGTTTCCATTAAGGAGCTATGGAGCTTGTTGAACTTCAATG
  
3' flanking region
GACGGTAAATCGTGGAAGCTTTAAACTTGTCGTTGGTAATACCGGCACAG
SNP nucleotide
TC
SNPdb format
GTACAGTCCTGTTTCCATTAAGGAGCTATGGAGCTTGTTGAACTTCAATG[T/C]
GACGGTAAATCGTGGAAGCTTTAAACTTGTCGTTGGTAATACCGGCACAG
  
Genomic location of solcap_snp_sl_100975  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18514 marker 18514
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)