SGN Marker T1232

SGN-M1852
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTAC15TH
Arabidopsis best BAC match: AC013430.5
Arabidopsis position: 1.1496000
Arabidopsis identities: 0.875
Best GenBank protein hit: AAF71804.1
Evalue: 1.4e-90
Identities: 0.605
Description: unknown protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49408)
Chromosome
4
Position
57.87 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47342)
Chromosome
4
Position
66.07 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39553)
Chromosome
4
Position
83.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1232 was used as an overgo probe on plate 7 [well G3]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TGGCAGTCAAGTTCAGCTGACACT
B sequence
GGGAAGACCTCTTTCAAGTGTCAG
AB sequence
TGGCAGTCAAGTTCAGCTGACACTTGAAAG
Marker sequence
GCTTAGGTGGCCTACCGGTAGAGATGTCATTTGGCATGCAAATAGCAGAA
ATGATTGGGCTACGGAATGAATCAAACTTTGTACGAGCTGGAGTCCGAAC
TATTTTGGATATTGGATGTGGCTATGGCAGTTTTGGGGCACATCTCTTTT
CTAGCCAACTGTTGACCATGTGTGTTGCAAACTATGAAGCTTCTGGCAGT
CAAGTTCAGCTGACACTTGAAAGAGGTCTTCCCGCAATGATTGGATCATT
TAATTCAAAGCAGTTGCCTTATCCATCTCTTTCCTTTGATATGATACACT
GTGCGGAATGTCATGTTGACTGGGATCAGAAAGATGGTATTTTTCTTGTT
GAAGTCGACCGATTGTTAAGGCCTGGTGGATATTTTGTCTGGACTTCAAC
TGTTACGAATACTCAGCGCTCCGTCCGCAACAAAGTGAGCCTCAAAAAAT
GGAACTTTGTCCAGAATTTTGCTGAAAGTATGTGCTGGAAGCTGTTAGCC
CAACAAGATGAAACTGCTGTATGGAAAAAGACAAGTTTAAAGAAATGTTA
TTTTGCAAGGAGACCAGGTGTTGGGCCTTCCATCTGCAGTAAAGGACAGG
ACATTGAATCCCCGTATTATCGACCTCTACAAGCATGCATTGCTGGAACC
CAAAGCCGCCGATGGATTCCTATTG
Genomic location of T1232  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1852 marker 1852
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)