SGN Marker solcap_snp_sl_100986

SGN-M18525

Synonyms  
SL1_00sc6004_2569365
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70604)
Chromosome
11
Position
90.21 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67087)
Chromosome
11
Position
93.40 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63553)
Chromosome
11
Position
108.23 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54856)
Chromosome
11
Position
52.76 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCTTGTAAATAATATTCGGAATAAGCCCGATTCATAACGGGTCGACCCGA
  
3' flanking region
CCTTTATCAGTAACAGCATAAGCGAAAATCACAAATCCAATTAATGCAGC
SNP nucleotide
AC
SNPdb format
TCTTGTAAATAATATTCGGAATAAGCCCGATTCATAACGGGTCGACCCGA[A/C]
CCTTTATCAGTAACAGCATAAGCGAAAATCACAAATCCAATTAATGCAGC
  
Genomic location of solcap_snp_sl_100986  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18525 marker 18525
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)