SGN Marker solcap_snp_sl_100994

SGN-M18533

Synonyms  
SL1_00sc6004_356540
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67097)
Chromosome
11
Position
71.84 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63563)
Chromosome
11
Position
88.45 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54864)
Chromosome
11
Position
50.52 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AACGCCGTGTACGGTACACCGCAAACAACATCGTATTTGGTAGATTCCGG
  
3' flanking region
AGTGAACCAACCAGAATTTGTGAAATCTGACGGAGAATCGAAGGGTATGA
SNP nucleotide
TC
SNPdb format
AACGCCGTGTACGGTACACCGCAAACAACATCGTATTTGGTAGATTCCGG[T/C]
AGTGAACCAACCAGAATTTGTGAAATCTGACGGAGAATCGAAGGGTATGA
  
Genomic location of solcap_snp_sl_100994  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18533 marker 18533
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)