SGN Marker solcap_snp_sl_100996

SGN-M18535

Synonyms  
SL1_00sc6004_456502
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70623)
Chromosome
11
Position
70.39 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67102)
Chromosome
11
Position
75.62 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63568)
Chromosome
11
Position
91.21 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54866)
Chromosome
11
Position
50.62 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ATTAGCTGGCTATTAGGAGACAGGTGTGATTTCACCTCTGGAATAATTTT
  
3' flanking region
TTGTGAAACCGACGATCATCATGAGATTCAACAAAACGCTGGGTCATATT
SNP nucleotide
TC
SNPdb format
ATTAGCTGGCTATTAGGAGACAGGTGTGATTTCACCTCTGGAATAATTTT[T/C]
TTGTGAAACCGACGATCATCATGAGATTCAACAAAACGCTGGGTCATATT
  
Genomic location of solcap_snp_sl_100996  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18535 marker 18535
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)