SGN Marker solcap_snp_sl_100999

SGN-M18538

Synonyms  
SL1_00sc6004_497749
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70626)
Chromosome
11
Position
71.22 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67104)
Chromosome
11
Position
76.56 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63570)
Chromosome
11
Position
91.88 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54869)
Chromosome
11
Position
50.66 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GAAAAAAGAATCATTCTACATTGGCACCGTAAAAACTCGACTGTGAAACT
  
3' flanking region
CAAACGTGAGTTACAATTTTAAACCATCATGCACAACTTCATCAACTCAC
SNP nucleotide
AG
SNPdb format
GAAAAAAGAATCATTCTACATTGGCACCGTAAAAACTCGACTGTGAAACT[A/G]
CAAACGTGAGTTACAATTTTAAACCATCATGCACAACTTCATCAACTCAC
  
Genomic location of solcap_snp_sl_100999  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18538 marker 18538
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)