SGN Marker solcap_snp_sl_101002

SGN-M18541

Synonyms  
SL1_00sc6004_502854
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70629)
Chromosome
11
Position
71.22 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54872)
Chromosome
11
Position
50.67 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TACAAGAATACAATTCGATAACTTGCAAAGATGGGATATCTCCAATTTCA
  
3' flanking region
AAGGGATTTCTTTTAGCTTGTTGCAAAACCTGAAAACTAAATGTTGGAGA
SNP nucleotide
AT
SNPdb format
TACAAGAATACAATTCGATAACTTGCAAAGATGGGATATCTCCAATTTCA[A/T]
AAGGGATTTCTTTTAGCTTGTTGCAAAACCTGAAAACTAAATGTTGGAGA
  
Genomic location of solcap_snp_sl_101002  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18541 marker 18541
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)