SGN Marker solcap_snp_sl_101003

SGN-M18542

Synonyms  
SL1_00sc6004_689170
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70632)
Chromosome
11
Position
72.32 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67108)
Chromosome
11
Position
77.51 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63574)
Chromosome
11
Position
93.23 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54873)
Chromosome
11
Position
50.85 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ATCTATTAACTGTACCAGTTCTATGAGTGGGTACGGGTTGGGTGCAGAGA
  
3' flanking region
TGGCATTGGATCTGCTTCTCTTCTTCCTGAAACATACACCGATCGCCCTA
SNP nucleotide
CG
SNPdb format
ATCTATTAACTGTACCAGTTCTATGAGTGGGTACGGGTTGGGTGCAGAGA[C/G]
TGGCATTGGATCTGCTTCTCTTCTTCCTGAAACATACACCGATCGCCCTA
  
Genomic location of solcap_snp_sl_101003  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18542 marker 18542
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)