SGN Marker solcap_snp_sl_101038

SGN-M18577

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54908)
Chromosome
4
Position
59.68 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ATGTTTATTTAAAAAGGTAAAATTGCTCCCCTCGACCAGAATTTGGTAAT
  
3' flanking region
CACAAATGGGTATATCACCTCCAAAGTCTCCACATAGTTCTATTCTTTCT
SNP nucleotide
AT
SNPdb format
ATGTTTATTTAAAAAGGTAAAATTGCTCCCCTCGACCAGAATTTGGTAAT[A/T]
CACAAATGGGTATATCACCTCCAAAGTCTCCACATAGTTCTATTCTTTCT
  

Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43543)
Chromosome
4
Position
71.70 cM
Confidence
uncalculated
Protocol
SNP


Yellow Stuffer x LA1589
Genomic location of solcap_snp_sl_101038  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18577 marker 18577
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)