SGN Marker T1241

SGN-M1858
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 1.02
Tomato EST read: TPTAD53TH
Arabidopsis best BAC match: AB006704.1
Arabidopsis position: 5.0190000
Arabidopsis identities: 0.781
Best GenBank protein hit: BAB08697.1
Evalue: 6.7e-43
Identities: 0.713
Description: polyamine oxidase [Arabidopsis thaliana]
Comment: "Plant PAOs catalyse the oxidation of polyamine substrates spermidine and spermine producing propane-1,3-diamine and 1-pyrroline or 1-(3-aminopropyl)pyrrolinium and H2O2."
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Eggplant-COSII   
Map version
63 (location: 42383)
Chromosome
1
Position
74.90 cM
Confidence
I
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39556)
Chromosome
1
Position
47.20 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 11365)
Chromosome
1
Position
89.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Eggplant-LXM 2002
Overgo hybridization and physical mapping 
T1241 was used as an overgo probe on plate 9 [well D8]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
ACAGTGGACTCAAGCTCAATACGG
B sequence
TGCACTTCCCGAACAACCGTATTG
AB sequence
ACAGTGGACTCAAGCTCAATACGGTTGTTC
Marker sequence
GATCACAGTGGGAAGATATTTCCGAGTGGAATATTCGGCGGACTCGTATA
AGAAAGCGGTGGACTCAGCAATTCAGAAACTCAGAAGCCAGGAAGGAAAT
CATAATGAAGACACCGACGATGCTGCTGAAACGCCGTCAACTCCAAAAAC
ACCAATAGAGCTGGCGATTGATTTCATTCTTCATGATTTTGAAATGGCAG
AAGTTGAGCCAATATCAACCTATGTAGATTTTGGTGAAAGAGAATTTCTG
GTTGCTGATGAAAGAGGATATGAACATTTGCTTTATAAAATGGCAGAAAA
TTTTCTTCTTACCTGTGAGGGTGAAATTATGGACAGTGGACTCAAGCTCA
ATACGGTTGTTCGGGAAGTGCACCACTCGAGAAACGGGGATTTGGTGACA
AC
Genomic location of T1241  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1858 marker 1858
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)