SGN Marker solcap_snp_sl_101047

SGN-M18586

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54917)
Chromosome
1
Position
70.52 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GCTCCAACAAATC
  
3' flanking region
TTTCTGTTGATTGAGGCACACAGAGAATGGGTAGGTAAAACATAATAGCC
SNP nucleotide
AG
SNPdb format
GCTCCAACAAATC[A/G]
TTTCTGTTGATTGAGGCACACAGAGAATGGGTAGGTAAAACATAATAGCC
  
Genomic location of solcap_snp_sl_101047  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18586 marker 18586
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)