SGN Marker solcap_snp_sl_101056

SGN-M18595

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54926)
Chromosome
3
Position
61.92 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GGTCCTCGGGCTTAAATCTGATGATCGGTGGTATGGTTGAAACCAGGCTT
  
3' flanking region
CCATGGGCTTTGCTGGTCATCTAGCCGCTGGCCTTGGATGTTTCAAGTAA
SNP nucleotide
TG
SNPdb format
GGTCCTCGGGCTTAAATCTGATGATCGGTGGTATGGTTGAAACCAGGCTT[T/G]
CCATGGGCTTTGCTGGTCATCTAGCCGCTGGCCTTGGATGTTTCAAGTAA
  

Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43556)
Chromosome
3
Position
90.40 cM
Confidence
uncalculated
Protocol
SNP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43185)
Chromosome
3
Position
91.90 cM
Confidence
uncalculated
Protocol
SNP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Assay data  
5' flanking region
ATGATCGGTGGTATGGTTGAAACCAGGCTT
ASPE primers (5'-3')
TATGGTTGAAACCAGGCTTG
TATGGTTGAAACCAGGCTTT
3' flanking region
CCATGGGCTTTGCTGGTCATCTAGCCGCTG
SNP nucleotide
GT
SNPdb format
ATGATCGGTGGTATGGTTGAAACCAGGCTT[G/T]
CCATGGGCTTTGCTGGTCATCTAGCCGCTG
  
Genomic location of solcap_snp_sl_101056  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18595 marker 18595
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)