SGN Marker solcap_snp_sl_101063

SGN-M18602

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54933)
Chromosome
3
Position
2.05 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TATTTTTTGGGTTGCTGAATAGCTCTTACTGAATCTCTTTAACATCTATT
  
3' flanking region
TTGTGCTGAATATATATCTGGAGTGGTTACTCATTTTAATGGACAAGCAA
SNP nucleotide
AG
SNPdb format
TATTTTTTGGGTTGCTGAATAGCTCTTACTGAATCTCTTTAACATCTATT[A/G]
TTGTGCTGAATATATATCTGGAGTGGTTACTCATTTTAATGGACAAGCAA
  

Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43559)
Chromosome
3
Position
13.70 cM
Confidence
uncalculated
Protocol
SNP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43198)
Chromosome
3
Position
13.60 cM
Confidence
uncalculated
Protocol
SNP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Assay data  
5' flanking region
AGCTCTTACTGAATCTCTTTAACATCTATT
ASPE primers (5'-3')
CTCCAGATATATATTCAGCACAAT
CTCCAGATATATATTCAGCACAAC
3' flanking region
TTGTGCTGAATATATATCTGGAGTGGTTAC
SNP nucleotide
AG
SNPdb format
AGCTCTTACTGAATCTCTTTAACATCTATT[A/G]
TTGTGCTGAATATATATCTGGAGTGGTTAC
  
Genomic location of solcap_snp_sl_101063  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18602 marker 18602
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)