SGN Marker solcap_snp_sl_101089

SGN-M18628

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54959)
Chromosome
11
Position
50.39 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CTTTAGAGCCTCAGAAATATCTTTGGGAAAAACGATATTTGGTGGCATTG
  
3' flanking region
GGACTGTTTTCTGATGTTGTGATGGAATTTCTGTTTTCATGTCGAAGTAA
SNP nucleotide
AG
SNPdb format
CTTTAGAGCCTCAGAAATATCTTTGGGAAAAACGATATTTGGTGGCATTG[A/G]
GGACTGTTTTCTGATGTTGTGATGGAATTTCTGTTTTCATGTCGAAGTAA
  

Map: Sun1642 x LA1589   
Map version
85 (location: 43773)
Chromosome
11
Position
78.10 cM
Confidence
uncalculated
Protocol
SNP


Sun1642 x LA1589

Assay data  
5' flanking region
CTTTGGGAAAAACGATATTTGGTGGCATTG
ASPE primers (5'-3')
CGATATTTGGTGGCATTGA
CGATATTTGGTGGCATTGG
3' flanking region
GGACTGTTTTCTGATGTTGTGATGGAATTT
SNP nucleotide
AG
SNPdb format
CTTTGGGAAAAACGATATTTGGTGGCATTG[A/G]
GGACTGTTTTCTGATGTTGTGATGGAATTT
  

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43231)
Chromosome
11
Position
65.90 cM
Confidence
uncalculated
Protocol
SNP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Assay data  
5' flanking region
CTTTGGGAAAAACGATATTTGGTGGCATTG
ASPE primers (5'-3')
CGATATTTGGTGGCATTGA
CGATATTTGGTGGCATTGG
3' flanking region
GGACTGTTTTCTGATGTTGTGATGGAATTT
SNP nucleotide
AG
SNPdb format
CTTTGGGAAAAACGATATTTGGTGGCATTG[A/G]
GGACTGTTTTCTGATGTTGTGATGGAATTT
  
Genomic location of solcap_snp_sl_101089  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18628 marker 18628
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)