SGN Marker T1252

SGN-M1867
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 6.07
Tomato EST read: TPTAE25TH
Arabidopsis best BAC match: AC004473.1
Arabidopsis position: 1.1049000
Arabidopsis identities: 0.561
Best GenBank protein hit: AAC24068.1
Evalue: 3.6e-68
Identities: 0.584
Description: Similar to red-1 (related to thioredoxin) gene gb|X92750 from Mus musculus [Arabidopsis thaliana]
Comment: proposed redox regulator in nucleus
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49410)
Chromosome
5
Position
0.34 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47344)
Chromosome
5
Position
0.95 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39557)
Chromosome
5
Position
3.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1252 was used as an overgo probe on plate 1 [well G11]

Plausible BAC Matches:   P051A13,   P298F18,   P242C02,   P249E10

 Overgo Sequences

A sequence
ACCCCACTTAGTGATCCTTGATGC
B sequence
CACTACCTTCCCACTAGCATCAAG
AB sequence
ACCCCACTTAGTGATCCTTGATGCTAGTGG
Marker sequence
TCAGATCGTGACTTTCTTATTCGCAACAATGGTGACAAGGTTAAGCTTGA
TACTTTAAAGGAGAAAAAAATTGGTTTGTACTTTTCAGCATCATGGTGTG
GTCCGTGCAAACATTTCACCCCAAATTTGGTAGAGGCGTACAATGCTCTC
CTACCAAAAGGAGACTTTGAAGTTGTTTTCCTTACTACTGATATGGATGA
TGAATCTTTTAAGGAGTACTTTTCTAAAATGCCTTGGCTCGCTGTCCCAT
TCTCTGATTCTGAAACACGTAAACGTTTGAATGAATTGTTTGCTGGTAGG
GGAATACCCCACTTAGTGATCCTTGATGCTAGTGGGAAGGTAGTGACAAA
TAGCGGGGTTGAAATCATTGTTGAGCATGGGGTGGAGGGCTACCCTTTCA
CTCAAGAACGGCTAAACGAACTTAAAGAGCAAGAAGAAACCCGCTAAAGA
GAACAGTCTTTGAAATCTATCTTGGAGTCACAGTCAAGAAACTACGTAAT
TGCAGCTGATGGAAAGAAGGTACCTGTTGCTGAGCTTGAAGGCAAGATTA
TAGGCCTATATTTGTCAATTGCTTCTTTTGAAGAATGTGAATCCTTTACT
GGGAAGCTGATCGAGATGTATGACAAG
Genomic location of T1252  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1867 marker 1867
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)