SGN Marker solcap_snp_sl_10915

SGN-M18702

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55033)
Chromosome
11
Position
45.86 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCAAACTGGAAGTGAGGCTCCACGGCGCAGGGGGAAGAGACAGGATTTGG
  
3' flanking region
CACTGCAGCTGTTACTGAAGGGTTAAGTGTTCAGGATCCAAAATTAATTG
SNP nucleotide
AT
SNPdb format
TCAAACTGGAAGTGAGGCTCCACGGCGCAGGGGGAAGAGACAGGATTTGG[A/T]
CACTGCAGCTGTTACTGAAGGGTTAAGTGTTCAGGATCCAAAATTAATTG
  
Genomic location of solcap_snp_sl_10915  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18702 marker 18702
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)