SGN Marker T1257

SGN-M1871
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTAE60TH
Arabidopsis best BAC match: AC007259.4
Arabidopsis position: 1.0340000
Arabidopsis identities: 0.701
Best GenBank protein hit: CAB81264.1
Evalue: 1.5e-66
Identities: 0.721
Description: putative protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49412)
Chromosome
7
Position
63.21 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47346)
Chromosome
7
Position
72.47 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-LXCHM 2007   
Map version
68 (location: 43010)
Chromosome
7
Position
55.70 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-LXCHM 2007

PCR data   Exp. ID 44010
Forward primer (5'-3')
TTTTGGTTTTCTTGTTGGCTAA
Accessions and product sizes
Approximate temperature
58°C
Reverse primer (5'-3')
CCAACTAGGGTACACTCCAAACA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39560)
Chromosome
7
Position
72.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1257 was used as an overgo probe on plate 7 [well F9]

Plausible BAC Matches:   P140O20,   P203L07,   P218N19,   P031A22,   P018I08,   P089I03

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
GCACCTTTGTACGCTATTGTCTCC
B sequence
CGACCAACCCAATGAAGGAGACAA
AB sequence
GCACCTTTGTACGCTATTGTCTCCTTCATT
Marker sequence
GCCTCGTGCCGAATTCGGCACGAGGAGACTCTGTTTGATTTTGGTTTTCT
TGTTGGCTAACAACAAATATGGAATTGGATCTGGATCGTGGGCAAGTCAC
ACTGATAGTATCCAGTATATGTCTTATGCTGACTTTACATTTCAGCATAC
AGCTAGTGACAGAACATTTTACGTCATGGAAGAAGCCTAAAGAGCAAAAG
GCCATAATTATTATCGTCCTCATGGCACCTTTGTACGCTATTGTCTCCTT
CATTGGGTTGGTCGATTTCATGGGAAGCAAACCCTTTTTCACTTTCTTGG
AATCTGTCAAAGAATGTTATGAAGCAATTGTGATGGCTAAGTTCCTGGGG
TTGATGTACACTTACTTGAATATATCCATAAGCAAAAACATAGTCCCTGA
TGAAATTAAGGGAAGACAGATTCACCACTCATTCCCAATGACACTCTTCC
AGCCTCACACTGCTCATTTGAACCATCATACATTGAAGCTTCTCAAGAAC
TGGACATGGCAGTTTGTTGTGATTCGCCCTGTATGCTCTATTTTAATGAT
TGTTTTACAAATGTTTGGAGTGTACCCTAGTTGGGTTAGCTGGACCTTTA
CCATCATTTTAAACATATCC
Genomic location of T1257  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1871 marker 1871
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)