SGN Marker T1261

SGN-M1874
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 2.01
Tomato EST read: TPTAE85TH
Arabidopsis best BAC match: AL132975.1
Arabidopsis position: 3.1193000
Arabidopsis identities: 0.931
Best GenBank protein hit: CAA58230.1
Evalue: 4.6e-75
Identities: 0.913
Description: triosephosphate isomerase [Petunia x hybrida]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39562)
Chromosome
4
Position
24.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1261 was used as an overgo probe on plate 7 [well G1]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TGGGTTAAGAATGGCGGTGCTTTC
B sequence
CACTAACTTCACCGGTGAAAGCAC
AB sequence
TGGGTTAAGAATGGCGGTGCTTTCACCGGT
Marker sequence
GAGAAACTTTAGATCTCATTTCTTGTTGTACAATTCCCGTGAATCCTTCG
TCTTCATCGTAAAAATGGGCAGAACTTTCTTCGTCGGCGGTAACTGGAAA
TGCAATGGAACCAGTGAAGAGATCAAGAAGATAGTAGCGATACTCAATGC
TGGTCAAGTGCCATCACAAGATGTTGTTGAGGTTGTTGTGAGCCCTCCAT
TTGTATTTCTTCCTCTGGTCAAGAATGAGCTGCGATCTGATTTTCATGTT
GCTGCCCAAAATTGTTGGGTTAAGAATGGCGGTGCTTTCACCGGTGAAGT
TAGTGCTAATATGCTTGTTAATCTGAGCATTCCATGGGTCATTTTGGGTC
ATTCTGAAAGAAGAGCCATTTTAGGTGAATCAAATGAGTTTGTTGGAGAC
AAGGTAGCATATGCTCTTTCTCAAGGTTTGAAGGTAATTGCATGTGTTGG
GGAGACTCTTGAGCAAAGAGAATCAGGATCCACCATGGATGTTGTTGCAG
CACAAACAAAGGCTATTGCAGACCGAGTAAAAGATTGGTCAAATGTGGTG
ATAGCTTATGAGCCTGTTTGGGCTATTGGTACTGGAAA
Genomic location of T1261  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1874 marker 1874
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)