SGN Marker solcap_snp_sl_11456

SGN-M18766

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70724)
Chromosome
4
Position
63.86 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55097)
Chromosome
4
Position
58.32 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GCTGAACTTCCGGCGGCGGCGGTCAGATCCGCCGCCACCTCCGGCCGCCG
  
3' flanking region
AAAAGAAGACGGACTAGGAGTTGTAAAAACAAAGAGGAATTGGAGAATCA
SNP nucleotide
TG
SNPdb format
GCTGAACTTCCGGCGGCGGCGGTCAGATCCGCCGCCACCTCCGGCCGCCG[T/G]
AAAAGAAGACGGACTAGGAGTTGTAAAAACAAAGAGGAATTGGAGAATCA
  
Genomic location of solcap_snp_sl_11456  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18766 marker 18766
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)