SGN Marker solcap_snp_sl_11520

SGN-M18775

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70732)
Chromosome
4
Position
61.67 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55106)
Chromosome
4
Position
57.86 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTCAGGGAAAGCAACCCACTGGTTCTGTGGCCAAAATCCGCTTACTCCTC
  
3' flanking region
GAATCCATCCAAAACCTCCTTGCCCTTGTCATTCCGCCCTTTGTTCAAGG
SNP nucleotide
CG
SNPdb format
TTCAGGGAAAGCAACCCACTGGTTCTGTGGCCAAAATCCGCTTACTCCTC[C/G]
GAATCCATCCAAAACCTCCTTGCCCTTGTCATTCCGCCCTTTGTTCAAGG
  
Genomic location of solcap_snp_sl_11520  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18775 marker 18775
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)