SGN Marker solcap_snp_sl_11532

SGN-M18781

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70736)
Chromosome
4
Position
61.12 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67173)
Chromosome
4
Position
68.63 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63629)
Chromosome
4
Position
99.59 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55112)
Chromosome
4
Position
57.77 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCCTTCAACAACACCAAAGACTAGTCTTTTTCTCTCTATTTTTCTCTCTT
  
3' flanking region
CTATGTAAACACCATGTTATTGAGTCTTTCTTAGACAGAAGTATATTGGG
SNP nucleotide
AT
SNPdb format
TCCTTCAACAACACCAAAGACTAGTCTTTTTCTCTCTATTTTTCTCTCTT[A/T]
CTATGTAAACACCATGTTATTGAGTCTTTCTTAGACAGAAGTATATTGGG
  
Genomic location of solcap_snp_sl_11532  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18781 marker 18781
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)