SGN Marker solcap_snp_sl_11540

SGN-M18787

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70741)
Chromosome
4
Position
60.85 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67175)
Chromosome
4
Position
68.31 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55118)
Chromosome
4
Position
57.71 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCACGATTTCGAGAAATTGTGGGAAAAGCGAACAGCGTTTAAGGGTCAAC
  
3' flanking region
CCGAGGCAGCGGAAGTACCAGCCTTCTTTGCAAGAGCCAAAGGAGAAAGC
SNP nucleotide
AG
SNPdb format
TCACGATTTCGAGAAATTGTGGGAAAAGCGAACAGCGTTTAAGGGTCAAC[A/G]
CCGAGGCAGCGGAAGTACCAGCCTTCTTTGCAAGAGCCAAAGGAGAAAGC
  
Genomic location of solcap_snp_sl_11540  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18787 marker 18787
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)