SGN Marker T1266

SGN-M1879
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 10.01.01.99
Tomato EST read: TPTAF09TH
Arabidopsis best BAC match: AC003979.1
Arabidopsis position: 1.0480000
Arabidopsis identities: 0.750
Best GenBank protein hit: AAF00023.1
Evalue: 4.1e-42
Identities: 0.511
Description: conceptual translation [Arabidopsis thaliana]
Comment: similar match with gb|AAF00092.1|AF105064_1 (AF105064) GIGANTEA [Arabidopsis thaliana]
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49415)
Chromosome
12
Position
47.99 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47349)
Chromosome
12
Position
57.24 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39564)
Chromosome
12
Position
71.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1266 was used as an overgo probe on plate 5 [well A4]

Plausible BAC Matches:   P255N04,   P079O22,   P193C03

 Overgo Sequences

A sequence
ATGTGCCCTCTGTTGAGCTTGCAT
B sequence
CAAAAAGCAGGTCGAGATGCAAGC
AB sequence
ATGTGCCCTCTGTTGAGCTTGCATCTCGAC
Marker sequence
CGAGGCCTTCAGAGAACGTTCCCGCCTGATTCCTCTAGAGAAGAAACCAG
AAAAACCAGATATATTTTTGGCTCTGCCTTGAAAAATCTTGCTGTGGCAG
AACTGCGAACCATGGTTCATTCATTGTTCTTGGAGTCATGTGCCCTCTGT
TGAGCTTGCATCTCGACCTGCTTTTTGTTATCTTAACAGTATGTGTCAGT
CATGAAGCAAAACCAAATGGGAATAAAAGGCCTAAAGGTGAAGATACCTC
ACCTCACCCTAGTGAAATCGGGGTAGACACCTCAGGCCACCATTGGAAAA
CAAAGACCAATAGGGAGTAAGAAAGTGAAAAAACAAGGGCCTGTTGCAGC
ATTTGATTCTTATGTCCTTGCTTCTGTCTGTGGACCTTTCTTGCCGAGCC
TTCAGCTCTTCAGTATGATTTCAAGAGTGCCTAATTATCCAGATCCAAAA
ATCATCATGGATGAAGCCAAGCCTGCAAGTGATTCATCTACTGAGCTACG
AAATGGGATTCATTCTGCCGTCTCTCATACTCGGAGGATGTTGGAAATTT
TAGAGGCCCTTTTTTCTCTTAAACCCTCTTCTGTTGGAACCTCATGGAGC
TTCAGCTCAAATGAGATAGTTGCTGCAGCTATGGTAGCTGCTCATATTTC
TGATCTGTTTAAACCCCTCCAAGCTTGCATGCCCCTCTCTTT
Genomic location of T1266  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1879 marker 1879
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)