Notice: Due to a server issue, SGN was unavailable earlier today. We apologize for any inconvenience.

SGN Marker solcap_snp_sl_11562

SGN-M18792

Synonyms  
CL000412-0153
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70744)
Chromosome
4
Position
60.85 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55123)
Chromosome
4
Position
57.59 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TGAATGGAAAGGAATAACTTAAGAGATCTAATAAGGACTGAATTAAGAAG
  
3' flanking region
TATTTTTTTAGTTGCTTTTTTGTAAGGGTGGGCTTTGTGCTTCCTTTAAA
SNP nucleotide
AG
SNPdb format
TGAATGGAAAGGAATAACTTAAGAGATCTAATAAGGACTGAATTAAGAAG[A/G]
TATTTTTTTAGTTGCTTTTTTGTAAGGGTGGGCTTTGTGCTTCCTTTAAA
  
Genomic location of solcap_snp_sl_11562  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18792 marker 18792
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)