SGN Marker T1275

SGN-M1888
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTAF59TH
Arabidopsis best BAC match: AC005396.2
Arabidopsis position: 2.0870000
Arabidopsis identities: 0.781
Best GenBank protein hit: AAF21309.1
Evalue: 5.1e-12
Identities: 0.843
Description: seed maturation protein PM23 [Glycine max]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39566)
Chromosome
1
Position
149.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1275 was used as an overgo probe on plate 8 [well F4]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TATCAGGCATGTTGGGCCTTGCTT
B sequence
GAAACTGGTCTGATGGAAGCAAGG
AB sequence
TATCAGGCATGTTGGGCCTTGCTTCCATCA
Marker sequence
GCAGCCTTCTCCTTCTCCCTCTCTACTTCTCCTCAACCTATACGCAATTT
CAAACGCCTAACTATTTCTCCCTCTCTTTCTTCTCTTCCCTCTCGTTCAA
CCAAAATTCGTAATAAATCTTTGCACTTAAGAACCTGCTTCAATTTCTGC
TTCTTCGGCTTCTTCTTACCGATGATTTCAGTGCTAGCCACCAGAATTCT
CGATCCAAGAAATCAGTCCTCTCAAACCTTGATACCAAGAGATAGAGCCA
TTGGATGTGAGCCTTATTCAAAAAGATGTACCCACCCCACCTACCCATTG
ATGCAATGAAAAGAACTATATCAGGCATGTTGGGCCTTGCTTCCATCAGA
CCAGTTTCAAGTTCTAATTGAAGCTTTGTGGGAACCAATCTCCCAGCTTT
TGATCTCTTCAATGATGACTGGGTATCCCCTACCGGAATGCTGAGTACCG
GCTTTGTCTTGAAAAGAACATTGAAATATATGATGGAAACATTGGTAGAC
AAAAGCTTGAAGATTCCCAAGTTGGAGATGAGAAATTGCTGAATGAAAAT
ATATCGAGC
Genomic location of T1275  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1888 marker 1888
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)