SGN Marker T1278

SGN-M1891
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTAF69TH
Arabidopsis best BAC match: AB012248.1
Arabidopsis position: 5.1900000
Arabidopsis identities: 0.853
Best GenBank protein hit: BAB09451.1
Evalue: 3e-105
Identities: 0.885
Description: histone acetyltransferase [Arabidopsis thaliana]
Comment: no experimental data for BAB09451.1
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49417)
Chromosome
3
Position
55.70 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47351)
Chromosome
3
Position
68.60 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39567)
Chromosome
3
Position
83.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1278 was used as an overgo probe on plate 6 [well C10]

Plausible BAC Matches:   P108K15,   P141B13

 Overgo Sequences

A sequence
GCAAGGATGTTGACCTAAATGCGC
B sequence
CACGCTGCTGACTTTAGCGCATTT
AB sequence
GCAAGGATGTTGACCTAAATGCGCTAAAGT
Marker sequence
GCTCACTCATGGCGGCGGCGGCGGTAGCGGTAGCGGAGACCCGAAAGCTC
CCGCGGCCGGGAAGGGGCGGAGTTGTTTCCCTCGGCCTGACAGATGAAGA
AGCTAGAGTTCGTGCTATAACGGAGATCGTCAACAACATGGTGGAACTTT
CACGGAAAGGCAAGGATGTTGACCTAAATGCGCTAAAGTCAGCAGCGTGC
CGCAAATACGGGCTCTCTCGGGCTCCTAAGTTGGTAGAGATGATCGCTGC
TTTGCCTGACTCTGAACGTGAAACACTGCTTCCCAAACTCCGAGCCAAGC
CTGTCCGTACAGCCTCTGGAATAGCTGTCGTAGCTGTAATGTCCAAGCCT
CATCGTTGTCCTCATATAGCTACCACCGGAAACATTTGTGTCTATTGCCC
TGGCGGCCCCGATTCTGATTTTGAGTACAGTACACAGTCATACACGGGAT
ATGAACCTACTAGTATGCGAGCTATTCGAGCTAGATACAATCCTTATGTA
CAAGCTCGAAGCCGGATTGATCAACTAAAGAGATTGGGTCACAGTGTTGA
CAAGGTTGAATTTATCTTGATGGGAGGTACATTCATGTCATTGCCTGCTG
AATACCGTGATTACTTCACACGGAATCTCCATGATGCTTTATCCGGACAT
ACTTCTGCCAATGTT
Genomic location of T1278  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1891 marker 1891
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)