Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker solcap_snp_sl_12389

SGN-M18914

Synonyms  
3017_4_52
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70808)
Chromosome
12
Position
41.63 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67226)
Chromosome
12
Position
52.98 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63680)
Chromosome
12
Position
60.72 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55245)
Chromosome
12
Position
44.71 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GCTTTTGGACGATTCGATGATTCATTCAGCTTAGGGTCTATTAAGGCCTA
  
3' flanking region
ATTGCTGAATTCATCTCTACTTTGCTCTTTGTCTTCGCCGGAGTTGGTTC
SNP nucleotide
TC
SNPdb format
GCTTTTGGACGATTCGATGATTCATTCAGCTTAGGGTCTATTAAGGCCTA[T/C]
ATTGCTGAATTCATCTCTACTTTGCTCTTTGTCTTCGCCGGAGTTGGTTC
  
Genomic location of solcap_snp_sl_12389  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18914 marker 18914
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)