SGN Marker solcap_snp_sl_12732

SGN-M18940

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70821)
Chromosome
4
Position
31.64 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67238)
Chromosome
4
Position
44.31 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55271)
Chromosome
4
Position
4.65 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GATTAAGTTTTATCACTCGACCTGTTGTTAAGTTGCATCTTACCCGACGC
  
3' flanking region
ATGAACAACAATCCAAATAACCAGTCTTATTATAGGCTTCCCAAAGGGTC
SNP nucleotide
TC
SNPdb format
GATTAAGTTTTATCACTCGACCTGTTGTTAAGTTGCATCTTACCCGACGC[T/C]
ATGAACAACAATCCAAATAACCAGTCTTATTATAGGCTTCCCAAAGGGTC
  
Genomic location of solcap_snp_sl_12732  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D18940 marker 18940
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)