SGN Marker T1284

SGN-M1895
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 9.01
Tomato EST read: None
Arabidopsis best BAC match: AC002387.2
Arabidopsis position: 2.2430000
Arabidopsis identities: 0.633
Best GenBank protein hit: AAB82640.1
Evalue: 3.8e-36
Identities: 0.622
Description: putative pectinesterase [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39569)
Chromosome
1
Position
56.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1284 was used as an overgo probe on plate 8 [well F9]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TAGTGTTAGACCGTGCGTTACGTG
B sequence
TATGTGTTCAGTTGGGCACGTAAC
AB sequence
TAGTGTTAGACCGTGCGTTACGTGCCCAAC
Marker sequence
TCAGATTTTCTAAAAGTGTCACTTGACTTAGTGTTAGACCGTGCGTTACG
TGCCCAACTGAACACATATTCACTTGGTCCAAAATGTCGTAACGAGCGCG
AAAAAAACGCATGGGCTGATTGTATTGAACTCTTTGAAAACTCAATCAAC
AAAATCTAAAGCACAGTTGATCCAAACACAAAACGCTCAGCTACTGATGC
TCAAACATGGTTAAGTACAGCCTTCACAAATATCGAAACATGTAAAGCAG
GTTTCGAAGAATTAGGCGTTACGGATTATGTTATGCCACTAATGTCAAAT
AATAATGTGTCATCTTTAATAAGTAACGCTTTGGCTTTAAATCATGGTTA
TTATACTGAACCT
Genomic location of T1284  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1895 marker 1895
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)