SGN Marker T1286

SGN-M1897
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 2.01
Tomato EST read: TPTAG15TH
Arabidopsis best BAC match: AB010074.2
Arabidopsis position: 5.2000000
Arabidopsis identities: 0.848
Best GenBank protein hit: CAB93680.1
Evalue: 8.2e-86
Identities: 0.879
Description: plastidic phosphoglucomutase [Solanum tuberosum]
Comment: interconversion of hexose phosphates
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49418)
Chromosome
3
Position
1.38 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47352)
Chromosome
3
Position
24.43 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39570)
Chromosome
3
Position
26.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1286 was used as an overgo probe on plate 1 [well C1]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TCATGAGTGCAAGCCATAACCCTG
B sequence
TCATACTCAGGACCACCAGGGTTA
AB sequence
TCATGAGTGCAAGCCATAACCCTGGTGGTC
Marker sequence
GGGATCAGTTCATCTCTTCATCACCATAGATCCTTGTCATTTCTCAATTT
CCCCAAATTGTCTTCCTTTAAATATTGTTTTCGAACAATTTCAACTGTTC
CTTTCGTTGTCAGTGCATCCTCTGTTTCTCCATCATCTCCTTCTACATCC
GTTGCCCAATCTCAGATTAAATCAGTTCCTACCAAGCCTATTGAAGGTCA
AAAGACCGGTACCAGTGGTCTACGCAAAAAGGTTAAAGTGTTTATGCAGG
ACAATTACCTTGCCAATTGGATACAGGCATTGTTTAATTCTTTGCCGTTA
GAGGATTATAAGAATGGACTCTTGGTCTTAGGAGGTGATGGTCGATATTT
CAATCGAGAAGCTGCACAGATAATCATTAAAATTGCTGCTGGTAACGGTG
TTGGTAAAATATTGGTTGGCAGGGATGGTATACTGTCCACTCCAGCTGTA
TCTGCTGTGATACGGAAAAGAGAGGCAAATGGTGGCTTTATCATGAGTGC
AAGCCATAACCCTGGTGGTCCTGAGTATGATTGGGGTATCAAGTTCAATT
ATAGCAGTGGCCAACCAGCTCCCGAGTCTATCACGGACAAGATCTATGGA
AACACCCTTTCT
Genomic location of T1286  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1897 marker 1897
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)