SGN Marker solcap_snp_sl_13200

SGN-M19002

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70842)
Chromosome
10
Position
2.48 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67260)
Chromosome
10
Position
6.31 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63706)
Chromosome
10
Position
10.95 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55333)
Chromosome
10
Position
1.06 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTCTTAGGAGCAGGGCATTTGTATCCATCATTGATGAGATTAATTGACTT
  
3' flanking region
GGCATTGGAGTTGCTTTCGCCGGAACACCAAATTGCGTTCCTTTTATCTT
SNP nucleotide
CG
SNPdb format
TTCTTAGGAGCAGGGCATTTGTATCCATCATTGATGAGATTAATTGACTT[C/G]
GGCATTGGAGTTGCTTTCGCCGGAACACCAAATTGCGTTCCTTTTATCTT
  
Genomic location of solcap_snp_sl_13200  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19002 marker 19002
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)