SGN Marker solcap_snp_sl_1334

SGN-M19014

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55345)
Chromosome
6
Position
36.06 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCTGAAAATGGCGCAGTTGATAAAAGATAGCTCTGAGGGGATGAAGAGTA
  
3' flanking region
TTCTGAAACTTTTAGCAAGCCTCCATTAAAGACTTTGATAATACCGGGTA
SNP nucleotide
TG
SNPdb format
TCTGAAAATGGCGCAGTTGATAAAAGATAGCTCTGAGGGGATGAAGAGTA[T/G]
TTCTGAAACTTTTAGCAAGCCTCCATTAAAGACTTTGATAATACCGGGTA
  
Genomic location of solcap_snp_sl_1334  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19014 marker 19014
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)