Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

SGN Marker solcap_snp_sl_13456

SGN-M19038

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70855)
Chromosome
8
Position
29.30 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67271)
Chromosome
8
Position
21.15 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55369)
Chromosome
8
Position
51.51 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTTGATGGATCTCCGGGTCGGGTCGGGTTTGAATCTTTTTCGTCTTCTCC
  
3' flanking region
CCTCTTGAATCTCCTCCGATGACTCCACGTGGGCTGGCGGAGTCGATGCG
SNP nucleotide
AG
SNPdb format
TTTGATGGATCTCCGGGTCGGGTCGGGTTTGAATCTTTTTCGTCTTCTCC[A/G]
CCTCTTGAATCTCCTCCGATGACTCCACGTGGGCTGGCGGAGTCGATGCG
  
Genomic location of solcap_snp_sl_13456  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19038 marker 19038
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)