SGN Marker T1308

SGN-M1914
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTAH52TH
Arabidopsis best BAC match: AC020889.3
Arabidopsis position: 1.0879000
Arabidopsis identities: 0.781
Best GenBank protein hit: AAF79712.1
Evalue: 5.8e-51
Identities: 0.683
Description: similar to down syndrome critical region gene [Arabidopsis thaliana]/otherwise uncharacterized.e-28 {Homo sapiens]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39573)
Chromosome
3
Position
139.50 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1308 was used as an overgo probe on plate 2 [well E3]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
CCAACCGCATTTATCGCCCTAATG
B sequence
TTCCCTTCCACTGGTTCATTAGGG
AB sequence
CCAACCGCATTTATCGCCCTAATGAACCAG
Marker sequence
GATATTCGTGGGGGTATCGGGTTTCGGCTGATCCGGCCGGTGCAAATAAA
ATCCCGGCGAGAAATCCGGCGGAAACTCCCGGAGGTTTTTTGGCTCTTAG
CAGCTTTGTTCTTTTTTGCCGTCTTCATCGTCATGTCAGTAGAGATCAAA
CTTTCGCGATCCAACCGCATTTATCGCCCTAATGAACCAGTGGAAGGGAA
AATCGTGACGAAGCTCTCTTCTTCCATTTCCCATCAAGGCATTCGACTCA
AAGTCAACGCTTCAGTCAACTTGCAGGTTCGAGGAGGATCAGCTGGTGTT
ATTGAATCTTTTTATGGTGTTATCAAGCCTATAACAATTCTGAATAAGAC
GATTGAGGTCCTAAAATCTGGTAGGATCAGCTCAGGTTCTACAGAGATCC
CATTTTCCTTCTGGTTGAAAGATCCAGGAGAAAAACCTTTAGAAAAATTT
TACGAAACATATCATGGTGGGGATATTAGCATTCAGTATCTGGTATCTGT
AGACATTTCAAGAGGATACTTACACAAGTCTCTATCTGCCACAATGGAGT
NTATAATTGAAAGCGAAAAGGAGAATCTTC
Genomic location of T1308  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1914 marker 1914
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)