SGN Marker solcap_snp_sl_13762

SGN-M19145

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70922)
Chromosome
1
Position
41.67 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67319)
Chromosome
1
Position
35.64 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63766)
Chromosome
1
Position
49.09 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55476)
Chromosome
1
Position
67.86 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCAAGCGCTGAACTTCTTGCCACCTTCTGTGACAACATTCTCAAAAAAGG
  
3' flanking region
GGGAGTGAGAAATTGAGTGATGAAGCTATTGAAGAAACGTTGGAAAAGGT
SNP nucleotide
AC
SNPdb format
TCAAGCGCTGAACTTCTTGCCACCTTCTGTGACAACATTCTCAAAAAAGG[A/C]
GGGAGTGAGAAATTGAGTGATGAAGCTATTGAAGAAACGTTGGAAAAGGT
  
Genomic location of solcap_snp_sl_13762  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19145 marker 19145
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)