SGN Marker solcap_snp_sl_14077

SGN-M19179

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70944)
Chromosome
11
Position
57.45 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67334)
Chromosome
11
Position
59.51 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55510)
Chromosome
11
Position
49.13 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ATAACAAGCTCCTGTCCAACCCATCCCGCTTCATCATCCAATCACACCTC
  
3' flanking region
ACAACTCAGCACACCGAGACCTCGCTTACTATCCTCATCACTCGATAATA
SNP nucleotide
AG
SNPdb format
ATAACAAGCTCCTGTCCAACCCATCCCGCTTCATCATCCAATCACACCTC[A/G]
ACAACTCAGCACACCGAGACCTCGCTTACTATCCTCATCACTCGATAATA
  
Genomic location of solcap_snp_sl_14077  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19179 marker 19179
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)