SGN Marker solcap_snp_sl_14081

SGN-M19180

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70945)
Chromosome
11
Position
57.18 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67335)
Chromosome
11
Position
58.88 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63781)
Chromosome
11
Position
69.72 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55511)
Chromosome
11
Position
48.94 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCCCATGGTTGTGAGGTGATTTTGGTGGTCGTTGACAGACTCAGCAAATA
  
3' flanking region
GGTCATTTCCTCCCACTGAGACATCCCTATACTGCTCAATCAGTTGCCCA
SNP nucleotide
AT
SNPdb format
TCCCATGGTTGTGAGGTGATTTTGGTGGTCGTTGACAGACTCAGCAAATA[A/T]
GGTCATTTCCTCCCACTGAGACATCCCTATACTGCTCAATCAGTTGCCCA
  
Genomic location of solcap_snp_sl_14081  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19180 marker 19180
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)