Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker solcap_snp_sl_14103

SGN-M19186

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70950)
Chromosome
4
Position
45.37 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67337)
Chromosome
4
Position
55.35 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63783)
Chromosome
4
Position
66.26 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55517)
Chromosome
4
Position
53.22 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CGTAGGGCCCGCAACAGAGTGGGAAGGTCTCCACCGTCGTGTACTCGCCG
  
3' flanking region
CGAAGACGACGTCGCCGCCGCTGATTAGATTTTCCATCAGAGAGTGGTTG
SNP nucleotide
AG
SNPdb format
CGTAGGGCCCGCAACAGAGTGGGAAGGTCTCCACCGTCGTGTACTCGCCG[A/G]
CGAAGACGACGTCGCCGCCGCTGATTAGATTTTCCATCAGAGAGTGGTTG
  
Genomic location of solcap_snp_sl_14103  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19186 marker 19186
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)