SGN Marker TG623

SGN-M192

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2200
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
CTAAGCTGAGTCTTCATTGGTGCATTTTTGTAAGTTCCAGCTACAGTGAGAATGTGAGCATAGACCCATACAATCATCACAGAGAATATA
ACAGCAAACCGGTCGAAGACATGCTTATCCCCTTTCATCAAATGAGGTATGTACTGTATACAGACACGAAAATATTTGTTAACATGTTAG
TTGAACTTGTAAAAGTCAGATTGAGGGCAACATTTTTTCGAAGTTCATAGAGTGAACTAGAAGAATTCTAAGAAAGTTGTGATCAAATGC
ACCTGTGAAAAGATTAAGAGAATGATAAGCTGCGGCAATCCAATTTCTGCACATTTTGCTACCTATATGCAAAAAAGTCAGTTACCAGTT
ACCATGACGTTTAAGCTTTTCATTTCAGTCAGAATCTAATTCGTAAAAATGTGACACAAATGGATTACCAGAGGAAAACCAAACTCATAT
AATCCAAATCCTGATAGAGCTACCAATGGAATAGCGGAGAGTG
Reverse sequence
CACCACCAAAACAGGATGAGAATATACCACATCCTGTTAAAGATCAGCTTCCAAATGTTTCTTACTGCATTACTAGTCCTCCACCTTGGC
GTAAGTTTCTATACCAACTTTCTTGAGAACACACTTTGTGCTTCATGCATATTTACTTCCCTCTATACGTTTCAGATTTTGAGATCCAAG
CAAGTCTATCTTTGATCGNATTTTTTTTTTTTTTTTTTTTTTACGAATTTTGCATTGTCAATGGGGACTTAAACCCAATTTTAAATCTTC
CCTCAAAGTTAAATTGTTGGGCTATCGAAAAAGGAAAAAAATCGGATTATATTTGGTTTCCCGGGGGGGATTAACAACGGACAATAACAA
GGGACTTTGGGTAATTCTACAAGGGGAGTTCGGGGAGGGGGGTGTGCCCCCAATTTTGTTTTTCCCTTTTGAAAGAAGAAAACGGTTTTT
GAAAAAACCCCAGCTCTTCCATGGGAAGATT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1450221.4e-0744 (9.1% of RFLP seq)-
SGN-U1450219.6e-1544 (9.1% of RFLP seq)-
SGN-U1613459.6e-1544 (9.1% of RFLP seq)-
SGN-U1450239.6e-1544 (9.1% of RFLP seq)-
SGN-U1648808.6e-4390 (18.7% of RFLP seq)-
Mapped locations  
Map: Tomato QTL map   
Map version
137 (location: 53906)
Chromosome
5
Position
0.00 cM
Confidence
uncalculated
Protocol
RFLP


Tomato QTL map

Map: Potato meta-QTL consensus map   
Map version
107 (location: 53369)
Chromosome
4
Position
56.26 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Maturity_4 MQTL_1_Late_blight_5.2 MQTL_2_Late_blight_4
Potato meta-QTL consensus map

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50416)
Chromosome
5
Position
0.76 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48348)
Chromosome
5
Position
6.25 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Eggplant-COSII   
Map version
63 (location: 42497)
Chromosome
3
Position
60.00 cM
Confidence
I
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40115)
Chromosome
5
Position
8.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 8522)
Chromosome
3
Position
62.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8521)
Chromosome
5
Position
0.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG623 was used as an overgo probe on plate 4 [well H12]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
AGTTCCAGCTACAGTGAGAATGTG
B sequence
TGTATGGGTCTATGCTCACATTCT
AB sequence
AGTTCCAGCTACAGTGAGAATGTGAGCATA
Marker sequence
CTAAGCTGAGTCTTCATTGGTGCATTTTTGTAAGTTCCAGCTACAGTGAG
AATGTGAGCATAGACCCATACAATCATCACAGAGAATATAACAGCAAACC
GGTCGAAGACATGCTTATCCCCTTTCATCAAATGAGGTATGTACTGTATA
CAGACACGAAAATATTTGTTAACATGTTAGTTGAACTTGTAAAAGTCAGA
TTGAGGGCAACATTTTTTCGAAGTTCATAGAGTGAACTAGAAGAATTCTA
AGAAAGTTGTGATCAAATGCACCTGTGAAAAGATTAAGAGAATGATAAGC
TGCGGCAATCCAATTTCTGCACATTTTGCTACCTATATGCAAAAAAGTCA
GTTACCAGTTACCATGACGTTTAAGCTTTTCATTTCAGTCAGAATCTAAT
TCGTAAAAATGTGACACAAATGGATTACCAGAGGAAAACCAAACTCATAT
AATCCAAATCCTGATAGAGCTACCAATGGAATAGCGGAGAGTG
Genomic location of TG623  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D192 marker 192
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)