SGN Marker T1319

SGN-M1923
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTAN09TH
Arabidopsis best BAC match: AC005292.4
Arabidopsis position: 1.0510000
Arabidopsis identities: 0.743
Best GenBank protein hit: AAF86997.1
Evalue: 1.5e-83
Identities: 0.761
Description: hypothetical protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49420)
Chromosome
5
Position
16.80 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47354)
Chromosome
5
Position
80.97 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39576)
Chromosome
5
Position
69.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1319 was used as an overgo probe on plate 12 [well D2]

Plausible BAC Matches:   P011M24,   P282A06

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
TCAGATGCAAGACCCTGGGATATC
B sequence
AAGAGTAAGCTGGGTGGATATCCC
AB sequence
TCAGATGCAAGACCCTGGGATATCCACCCA
Marker sequence
GAACATCACAATCTGGGACAACTAATTCTTTTGACGGGCAGAAACCTTAT
TATCAGATGCAAGACCCTGGGATATCCACCCAGCTTACTCTTGAAACAGC
TGTCATAGAATTACTTTCTCTTCCTGTTTCACCATCACAGATTGTCTCAT
CTCTAGTTCAAATTGTTGTTCACATACAACCAACCCTTGTTCAATCCAGC
AACGGGCTGCATGGAGCTGCTGGTAGTTCAGGACAAGGCTCTATTTTGCC
TACTTCTCCTTCAGGAGGAAGCACTGATTCTTTGGGTGCAACTAGGACGA
CTCCATCACTTTCAGGATTGAATACTTCTAATTTTGTTTCACGCAGTGGT
TATACTTGCCAGCAGCTGTCTTGCTTGTTAATCCAAGCATGTGGTCTTCT
TTTGGCACAACTTCCTCCAGAATTTCATGTGCAGCTATATGTTGAAGCTG
CACGCATAATAAAAGAAAGTTGGTGGCTTACTGATGCTAAAAGGTCTGTG
GGTGAATTAGAATCGGCTGTTAGTTATGCTCTACTAGATCCCACCTGGGC
TGCACAGGATAATACCTCAACAGCCATTGGTAATATTGTCGCACTGCTAC
ATGCTTTCTTCTGTAACCTCCCACAAGAATGGCTCGAGGGAACTCATCTT
ATCATT
Genomic location of T1319  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1923 marker 1923
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)