SGN Marker solcap_snp_sl_14714

SGN-M19242

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70983)
Chromosome
3
Position
64.92 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67365)
Chromosome
3
Position
51.95 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63807)
Chromosome
3
Position
59.05 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55573)
Chromosome
3
Position
55.80 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TATTTGAAATTCTTTTGCTCGTGTATAAGTTGGTTCTCTGCTTGGGAGTG
  
3' flanking region
ATAAAGGTTAGGTAAAAACAGTTTAGTTACGTAGTTTAGTACTAGATTTG
SNP nucleotide
CG
SNPdb format
TATTTGAAATTCTTTTGCTCGTGTATAAGTTGGTTCTCTGCTTGGGAGTG[C/G]
ATAAAGGTTAGGTAAAAACAGTTTAGTTACGTAGTTTAGTACTAGATTTG
  
Genomic location of solcap_snp_sl_14714  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19242 marker 19242
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)